(03348) Jian-Xun FENG et al:Analysis of Five Differentially Expressed Gene Familiesin Fast Elongating Cotton Fiber

http://www.abbs.info e-mail: [email protected]

ISSN 0582-9879 Acta Biochim et Biophysica Sinica 2004, 36(1):51-57 CN 31-1300/Q

Analysis of Five Differentially Expressed Gene Families in Fast Elongating Cotton Fiber

Jian-Xun FENG, Sheng-Jian JI, Yong-Hui SHI, Yu XU, Gang WEI, and Yu-Xian ZHU*

( National Laboratory of Protein Engineering and Plant Genetic Engineering, College of Life Sciences, Peking University, Beijing 100871, China )

Abstract Using the suppression subtractive hybridization method, we isolated five gene families, including proline-rich proteins (PRPs), arabinogalactan proteins (AGPs), expansins, tubulins and lipid transfer proteins (LTPs), from fast elongating cotton fiber cells. Expression profile analysis using cDNA array technology showed that most of these gene families were highly expressed during early cotton fiber developmental stages (0–20 day post anthesis, DPA). Many transcripts accumulated over 50-fold in 10 DPA fiber cells than in 0 DPA samples. The entire gene family —AGP, together with 20 individual members in other 4 gene families, are reported in cotton for the first time. Accumulation of cell wall proteins, wall loosening enzymes, microtubules and lipid transfer protein may contribute directly to the elongation and development of fiber cells.

Key words cotton fiber; cDNA array; cell elongation; arabinogalactan protein; lipid transfer protein

Cotton fibers are long (30–40 mm) and thin (15 μm) unicellular structures that emerge from certain epidermal cells in the outer integuments of cotton ovules. Fiber development can be conceptually separated into four phases: initiation, elongation, secondary wall deposition and maturation [1]. Usually fibers initiate at or just before anthesis and soon enter a rapid elongation period that lasts until 25 d post anthesis (DPA). Fiber cells display the most rapid elongating rate around 10 DPA. During secondary wall deposition stage (20–45 DPA), fibers undergo mainly cellulose biosynthesis, which results in very high cellulose content (about 90%) in these cells. In the past decade, great efforts have been made to elucidate molecular mechanisms of cotton fiber development, many cotton genes have been isolated, and even transgenic cottons have been obtained [2,3]. However, no single crucial fiber factor has been discovered, which suggests that regulation of fiber development may require a number of genes [4].

Proline-rich proteins (PRPs) and arabinogalactan proteins (AGPs) are two important cell wall structural proteins[5,6]. PRPs are widely distributed in plants and are encoded by gene families. PRP members showed to be regulated both temporally and spatially during plant development [7]. In cotton, several different PRP genes were isolated and analyzed [8,9]. AGPs are a family of proteoglycans that have been implicated in various aspects of cellular activities [10,11]. Expansin(EXP), encoded by a highly conserved multigene family, mediate pH-dependent extension of plant cells by disrupting hydrogen bonds at the interfaces between individual cell wall polymers [6,12,13]. Expansins appear to be involved in a variety of plant processes, such as cell growth and polarity, root hair formation and growth, organogenesis and fruit ripening [14]. Several expansin genes were reported from cotton fiber [15,16]. Microtubules play central roles in many important cellular processes in higher plants [17]. Microtubules consist mainly of α-tubulin (ATub) and β-tubulin (BTub), both of which are encoded by multigene families in plants [2]. In cotton, nine α-tubulin and seven β-tubulin isotypes were

identified using two-dimensional gels, and the expression of α-tubulin genes were studied in fiber cells [18,19].However, only two β-tubulin genes were isolated and characterized so far [2,20].

Lipid transfer proteins (LTPs) are small cysteine-rich lipid-binding proteins and are also called non-specific LTPs (nsLTPs) since they transfer membrane lipids with no specificity. In plants, LTPs are probably involved in somatic embryogenesis, in defence against pathogens, and in the formation and reinforcement of waxy cuticle layers in plant surface [21,22]. Several plant LTPs have been identified in cotton fibers [21,23,24]. Despite recent progress in cotton gene isolation, there is no report concerning the expression patterns of gene families as a whole.

In this work, five gene families that are preferential to cotton fiber were identified from a subtractive cDNA library, and their RNA levels during the early cotton fiber development stages were studied .

Materials and Methods

Plant materials

Upland cotton and its fuzzless-lintless mutant (fl) were field grown during the summer of 2001. The mutant was originally discovered in an upland cotton (Gossypium hirsutum L. cv. Xuzhou 142) field in China [25]. Immediately after harvest, developing ovules were excised from each boll and fiber cells were carefully scraped from the epidermis of the ovules. All harvested plant materials were frozen in liquid nitrogen and stored at –80 ℃ before use.

cDNA array preparations

Suppression subtractive hybridization was carried out using cDNAs prepared from 10 DPA cotton fiber and fl mutant ovule as tester and driver, respectively. The subtracted cDNAs were inserted directly into the T/A cloning vector to transform E. coli DH5α cells, which produced the resultant subtractive cDNA library[4]. The clones with different gene families were selected from the subtractive library and cultured in 200 μl of LB-Amp medium in 96- well plates at 37 ℃. The cDNA inserts were amplified by PCR in a 96-well PTC200 peltier thermal cycler (MJ Research, USA) following the procedure described previously [4]. All PCR products were analyzed by agarose gel electrophoresis and quantified using a spectrophotometer. Then DNA (0.3 μg) samples were printed from PCR plates onto the nylon membranes (Roche, Germany) using the Biomek2000 laboratory automation workstation (Beckman Coulter, USA). The cotton ubiquitin was also printed onto each membrane as the internal controls. Distilled water, PCR primers and vector DNA were used as the negative controls.

Hybridization of cDNA arrays, image acquisition and analysis

RNA isolated from 0, 5, 10 and 20 DPA cotton fibers were used to prepare probes for expression pattern analysis. Images were acquired by scanning the membranes with a Typhoon 9210 scanner (Molecular Dynamics, USA). Data analysis was performed using ArrayVision 6.0 software (Imaging Research, USA). The radioactive intensity of each spot was quantified as volume values and the levels of the local background were subtracted to obtain the subtracted volume values designated as sVOL. Ubiquitin cDNA was used as the internal control, its subtracted volume value was termed as sRef. Normalization among all images was performed by dividing sVOL of each spot by the sRef value in the same image, resulting in a normalized volume value (nVOL) for each spot. nVOL values were comparable among all obtained images. The nVOL values of each gene at 5, 10 and 20 DPA were divided by that at 0 DPA to obtain the fold of increase in the gene expression level.

Semi-quantitative RT-PCR

Total RNA was isolated from wild type cotton fibers. First-strand cDNA was synthesized from 5 μg total RNA using SUPERSCRIPT first-strand synthesis system for RTPCR (Gibco, New York, USA). One tenth of the synthesized first-strand cDNA was used as templates in 50-μL PCR with gene-specific RT-PCR primers designed according to the cDNA sequence and synthesized commercially (TaKaRa, Dalian, China). Parallel reactions using cotton ubiquitin primers served to normalize the amount of template added. According to the transcription level of these family genes, some clones were chosen to verify the result of microarray by RT-PCR. All RT-PCR primers used in this study are listed in Table1.

Table 1 The sequence and characterization of RT-PCR primers

	Primer sequences	Tmperature of annealing	Cycles
PRP2	Sense : ATTGTTCATTGTTGCTACAAATG	55 ℃	25
	Antisense: GAGCAACTGGTCTCTCTTCAAAC
PRP4	Sense : GGATGGGCTCTGCTCAATCTG	53 ℃	25
	Antisense: CAAAAGGTAAAAAAATAATAATGTC
LTP6	Sense : GCATGTCTGTTGGTGTTGTGC	59 ℃	25
	Antisense: ATCCAATGTAGCAAGCAAGCC
LTP10	Sense : AAAGCCCCCACCCTGGATTGT	60 ℃	25
	Antisense: ATGGATATAACAAACATAGCCGCA
BTub8	Sense : GGCAAGTTTTGGGAAGTAGTATGT	52 ℃	25
	Antisense: TCCCTTAGCCCAGTTATTGCC
BTub9	Sense : GGGGAAGGAATGGATGAAATG	60 ℃	25
	Antisense: ACCAAGTAGTCCCCAAAAACACC
EXP2	Sense : TTCAAGGGTATGGAACGAGCA	57 ℃	25
	Antisense: GATGCCTCCTTTCTTCACACA
EXP4	Sense : TCAGTGTCCATCAAGGGTTCC	58 ℃	25
	Antisense: GCACTTGCTCGCCTATTTCAC
Ubiquitin	Sense : AAGACCTACACCAAGCCCAAGA	60 ℃	25
	Antisense: CTCTTTCCTCAGCCTCTGAACCT

Results

Isolation of five gene families

From a pool of subtractive cDNA fragments that were either expressed only in cotton fiber or displayed in significantly higher levels (>2-fold) in fibers compared to mutant

ovules, five large gene families, including PRPs, AGPs, expansins, tubulins and LTPs were identified. PRPs, expansins, tubulins and LTPs showed high sequence identities

with their homologs reported previously in cotton fiber and other plants (data not shown). AGPs shared 58％–59% identities in the deduced amino acid level (data not shown). Among the 32 independent cDNAs (6 PRPs, 5 AGPs, 4 expansins, 6 tubulins, 11 LTPs) belonging to these families, 20 are potential new members. Because no AGP gene families have been reported in cotton previously, all sequences of these cDNAs are deposited in the EST division of GenBank with accession numbers from CB350396 to CB350561 and can be accessed individually from the supplementary material of Ji et al. [4].

Expression analyses by cDNA array

We studied the expression patterns of these gene families during early cotton fiber development. The printed cDNA arrays were hybridized to [33P]-labeled probes prepared from 0, 5, 10 and 20 DPA wild-type cotton RNA,respectively (Fig. 1). Most cDNAs showed very low expression levels in 0 DPA cotton fiber and were usually activated after 5 DPA. A major portion of these cDNAs reached peak levels around 10 DPA with decreases observed thereafter, which indicated their potential importance in the fiber elongation phase. The semi-quantitative RT-PCR result shown in Fig. 2 was almost similar to the microarray result of these gene families. So the result of microarray is reliable.

Fig. 1 Microarray analysis showing different expression patterns for the five gene families during early fiber development

[33P]-labeled cDNA probes were prepared from RNAs that were isolated from 0, 5, 10 and 20 DPA cotton fibers. P1–P6: PRP1 to PRP6; A1–A5: AGP1 to AGP5; E2–E5: EXP2 to EXP5; BT1, 4, 8, 9: BTub1, 4, 8, 9; AT2, 4: ATub2, 4; L1–L8 and L10–L12: LTP1– LTP8 and LTP10 –LTP12. Cotton ubiquitin gene (U) was used as the positive control, and PCR primers (P), ddH2O (H) and vector DNA (V) were used as negative controls. Their locations were shown in the key.

Fig. 2 Differential accumulation of different members of 4 gene families as verified by RT-PCR

UBQ, ubiquitin.

Expression profiling of the gene families

Data obtained from the cDNA arrays were quantified and expressed as number of folds increased at a specific date in comparison with the intensities of 0 DPA ovules. Five gene families were analyzed and plotted in Fig. 3. The levels of PRP4 and 5 were 240 and 256-fold higher in 10 DPA fiber cells than in 0 DPA ovules. A sharp decline was visible for both messengers when quantified at 20 DPA [Fig. 3(A)]. The other four PRPs were demonstrated to only have moderate changes in expression and their levels were accumulated less than 20 folds during all phases of fiber development.

Different from that of PRPs, mRNAs of all AGPs accumulated to significantly high levels during early fiber elongation period and soon reached a plateau after 10 DPA[Fig. 3(B)]. The amounts of AGP2 and AGP4 increased to 400- and 423-fold higher in 10 DPA fiber cells than in 0 DPA ovules respectively. Other AGPs were found to be at least 150- to 200-fold more abundant in 10 DPA fiber cells. Fig. 3(C) showed the expression levels changes with the development of fiber elongation of the five cotton expansins (EXPs) discovered in the current work. EXP5 accumulated to over 100-fold in 10 DPA fibers than in 0 DPA ovules. EXP2 increased steadily in a relative low speed throughout the whole experimental period [Fig. 3(C)]. Fig. 3(D) analyzed the expression patterns for two gene families, including β-tubulins (BTubs) and α-tubulins (ATubs). BTub8 was noticeable because its transcripts increased 59- and 305-fold at 10 and 20 DPA compared with that at 0 DPA respectively, indicating it might be involved in middle and/or later stages of fiber development. Other tubulins usually reached the highest levels at around 10 DPA, and leveled out during 10–20 DPA.

LTP is a large gene family consisting of 11 members identified in the subtractive library. Among these 11 LTPs, the mRNA level of LTP6 accumulated 80-fold higher in 10 DPA than in 0 DPA ovules, while the mRNA levels of other 10 LTPs never increased higher than 35-fold. Usually, the expression of LTPs reached highest expression levels at around 10 DPA and then decreased steadily during 10–20 DPA [Fig. 3(E)]. LTP11 reached its highest level at 5 DPA.

All the cDNAs reported in the current work were under the same designations as specified in Ji et al.[4]. Several redundant tubulins were excluded from this figure while the original designations were followed so that sequence data is easily tracked down.

Fig. 3 Individual members of each gene family accumulated to different levels during the fiber elongation period

Transcript levels for the members of gene families are shown. (A) PRP. (B) AGP. (C) Expansin. (D) Tubulin. (E) LTP. The values for the axis of relative expression level referring to the folds of the increase of expression level at 5, 10 and 20 DPA compared with that at 0 DPA.

Discussion

The elongation or directional expansion of plant cells occurs by two main processes: diffuse growth and tip growth [26]. During growth and elongation, plant cells undergo many cellular changes such as modification of cell wall composition and organization. Structural proteins including PRPs and AGPs are known to play crucial roles in restructuring the cell wall [27]. PRPs may function by regulating actin polymerization and promoting membrane protrusions [28,29] and a particular PRP from Arabidopsis was needed for root hair initiation by forming new cell wall materials [7]. AGPs are presumably involved in the molecular interaction and cellular signaling at the cell surface [11] and are also known to be associated with cell expansion during root and pollen tube growth [30–32]. SOS5, an Arabidopsis AGP homolog was required for normal cell expansion [33] and fucosylated AGPs were required for elongation of Arabidopsis root cells [34]. An AGP from tobacco stimulated pollen tube elongation both in vivo and in vitro [35]. The finding that many members of these two gene families accumulated to very high levels in early developing cotton fiber cells [Fig. 3(A) and (B)] may be a further indication of their importance during cell elongation processes.

Cell wall expansion requires moving apart of the cellulose microfibrils in the cell wall. Expansins are such a family of proteins needed for disrupting the non-covalent

bonds between the cellulose microfibrils and cross-linked glycans [36]. It has been shown that different expansins can be expressed in different developmental stages [26], so that the maximum expression of expansin genes could be required for the initiation of expansion growth [37,38]. In this work, we found that the accumulation rates of expansin, especially that of EXP5, were in full accordance with the rate of fiber expansion [Fig. 3(C)]. We suggest that cells may produce large amounts of wall-loosening enzymes, including expansins, to facilitate the extremely high rate of cell wall expansion during the early cotton fiber growth phase.

Microtubules are key components of the eukaryotic cytoskeletons and are also suggested to play important roles in plant cell expansion for both tip growth and diffuse growth mechanisms [34]. Extensive mutant studies and drug-treatments have shown the importance of microtubules in the elongation of specialized single-cell tissues such as trichomes, root hairs and pollen tubes [39–42]. Ji et al. [20] found that the over-expression of a cotton β- tubulin induced the elongation of fission yeast cells. Li et al. [2] reported that preferential accumulation of a cotton β-tubulin gene improved longitudinal growth potential of a developing fiber cell. Accumulation of various tubulin transcripts will undoubtedly contribute to the rapidly elongation of fiber cells.

Although the precise biological functions of LTPs have not been clearly confirmed yet, they are probably involved in the formation and reinforcement of surface layers of plant cells as reported previously [22]. It was shown that extracellular wax matrix was involved in many important cell-signaling pathways such as epidermal cell differentiation and cell adhesion [43–45]. The existence of fiberspecific LTPs also suggested their roles in the fiber development. Although some individual members of the gene families studied in this work have been reported previously [8,15,19,23], the results in this paper constitute the most complete characterization of these families in the

elongation of cotton fibers so far. We believe that elucidation of the molecular functions of genes preferentially involved in the early fiber growth phase may help decipher

the mechanisms controlling cell elongation.

Acknowledgements

We thank Prof. M.-H. Liu for her assistance in preparing the cDNA array and scanning the phosphor image.

References

1 Basra AS, Malik CP. Development of the cotton fiber. Int Rev Cytol, 1984,89: 65–113

2 Li XB, Cai L, Cheng NH, Liu JW. Molecular characterization of the cotton GhTUB1 gene that is preferentially expressed in fiber. Plant Physiol, 2002, 130: 666–674

3 Ruan YL, Llewellyn DJ, Furbank RT. Suppression of sucrose synthase gene expression represses cotton fiber cell initiation, elongation, and seed development. Plant Cell, 2003, 15: 952–964

4 Ji SJ, Lu YC, Feng JX, Wei G, Li J, Shi YH, Fu Q et al. Isolation and analyses of genes preferentially expressed during early cotton fiber development by subtractive PCR and cDNA array. Nucleic Acids Res, 2003, 31: 2534–2543

5 Cassab GI. Plant cell wall proteins. Annu Rev Plant Physiol Plant Mol Biol, 1998, 49: 281–309

6 Minorsky PV. The wall becomes surmountable. Plant Physiol, 2002, 128: 345–353

7 Bernhardt C, Tierney ML. Expression of AtPRP3, a proline-rich structural cell wall protein from Arabidopsis, is regulated by cell-type-specific developmental pathways involved in root hair formation. Plant Physiol, 2000, 122:705–714

8 John ME, Keller G. Characterization of mRNA for a proline-rich protein of cotton fiber. Plant Physiol, 1995, 108: 669–676

9 Tan H, Creech RG, Jenkins JN, Chang YF, Ma DP. Cloning and expression analysis of two cotton (Gossypium hirsutum L.) genes encoding cell wall proline-rich proteins. DNA Seq, 2001, 12: 367–380

10 Schultz CJ, Johnson KL, Currie G, Bacic A. The classical arabinogalactan protein gene family of Arabidopsis. Plant Cell, 2000, 12:1751–1768

11 Showalter AM. Arabinogalactan-proteins: Structure, expression and function.Cell Mol Life Sci, 2001, 58:1399–1417

12 Shcherban TY, Shi J, Durachko DM, Guiltinan MJ, McQueen-Mason SJ, Shieh M, Cosgrove DJ. Molecular cloning and sequence analysis of expansins —a highly conserved, multigene family of proteins that mediate cell wall extension in plants. Proc Natl Acad Sci USA, 1995, 92: 9245–9249

13 Li Y, Darley CP, Ongaro V, Fleming A. Schipper O, Baldauf SL, McQueen- Mason SJ. Plant expansins are a complex multigene family with an ancient evolutionary origin. Plant Physiol, 2002, 128: 854–864

14 Lee Y, Choi D, Kende H. Expansins: Ever-expanding numbers and functions. Curr Opin Plant Biol, 2001, 4: 527–532

15 Orford SJ, Timmis JN. Specific expression of an expansin gene during elongation of cotton fibres. Biochim Biophys Acta, 1998, 1398: 342–346

16 Harmer SE, Orford SJ, Timmis JN. Characterisation of six alpha-expansin genes in Gossypium hirsutum (upland cotton). Mol Genet Genomics, 2002, 268: 1–9

17 Kopczak SD, Haas NA, Hussey PJ, Silflow CD, Snustad DP. The small genome of Arabidopsis contains at least six expressed α-tubulin genes. Plant Cell, 1992, 4:539–547

18 Dixon DC, Seagull RW, Triplett BA. Changes in the accumulation of α- and β-tubulin isotypes during cotton fiber development. Plant Physiol, 1994, 105: 1347–1353

19 Whittaker DJ, Triplett BA. Gene-specific changes in α-tubulin transcript accumulation in developing cotton fibers. Plant Physiol, 1999, 121: 181–188

20 Ji S, Lu Y, Li J, Wei G, Liang X, Zhu Y. A β-tubulin-like cDNA expressed specically in elongating cotton fibers induces longitudinal growth of fission yeast. Biochem Biophys Res Commun, 2002, 296: 1245–1250

21 Orford SJ, Timmis JN. Expression of a lipid transfer protein gene family during cotton fibre development. Biochim Biophys Acta, 2000, 1483: 275–284

22 Blein JP, Coutos-Thevenot P, Marion D, Ponchet M. From elicitins to lipidtransfer proteins: A new insight in cell signalling involved in plant defence mechanisms. Trends Plant Sci, 2002, 7: 293–296

23 Ma DP, Liu HC, Tan H, Creech RG, Jenkins JN, Chang YF. Cloning and characterization of a cotton lipid transfer protein gene specifically expressed in fiber cells. Biochim Biophys Acta, 1997, 1344: 111–114

24 Liu HC, Creech RG, Jenkins JN, Ma DP. Cloning and promoter analysis of the cotton lipid transfer protein gene Ltp3. Biochim Biophys Acta, 2000, 1487: 106–111

25 Zhang T, Pan J. Genetic analysis of a fuzzless-lintless mutant in Gossypium hirsutum L. Jiangsu J Agric Sci, 1991, 7: 13–16

26 Martin C, Bhatt K, Baumann K. Shaping in plant cells. Curr Opin Plant Biol, 2001, 4:540–549

27 Varner JE, Lin LS. Plant cell wall architecture. Cell, 1989, 56: 231–239

28 Zhao WM, Jiang C, Kroll TT, Huber PW. A proline-rich protein binds to the localization element of Xenopus Vg1 mRNA and to ligands involved in actin polymerization. EMBO J, 2001, 20: 2315–2325

29 Holt MR, Koffer A. Cell motility: Proline-rich proteins promote protrusions. Trends Cell Biol, 2001, 11: 38–46

30 Willats WG, Knox JP. A role for arabinogalactan proteins in plant cell expansion: Evidence from studies on the interaction of β-glucosyl Yariv reagent with seedlings of Arabidopsis thaliana. Plant J, 1996, 9: 919–925

31 Yang Z. Signaling tip growth in plants. Curr Opin Plant Biol, 1998, 1: 525– 530

32 Roy S, Jauh GY, Hepler PK, Lord EM. Effects of Yariv phenylglucoside on cell wall assembly in the lily pollen tube. Planta, 1998, 204: 450–458

33 Shi H, Kim Y, Guo Y, Stevenson B, Zhu JK. The Arabidopsis SOS5 locus encodes a putative cell surface adhesion protein and is required for normal cell expansion. Plant Cell, 2003, 15: 19–32

34 van Hengel AJ, Roberts K. Fucosylated arabinogalactan-proteins are required for full root cell elongation in Arabidopsis. Plant J, 2002, 32: 105–113

35 Wu HM, Wong E, Ogdahl J, Cheung AY. A pollen tube growth-promoting arabinogalactan protein from Nicotiana alata is similar to the tobacco TTS protein. Plant J, 2000, 22:165–176

36 Cosgrove DJ. Loosening of plant cell walls by expansins. Nature, 2000, 407: 321–326

37 Rose JK, Cosgrove DJ, Albersheim P, Darvill AG, Bennett AB. Detection of expansin proteins and activity during tomato fruit ontogeny. Plant Physiol, 2000, 123: 1583–1592

38 Ruan YL, Llewellyn DJ, Furbank RT. The control of single-celled cotton fiber elongation by developmentally reversible gating of plasmodesmata and coordinated expression of sucrose and K+ transporters and expansin. Plant Cell,

2001,13: 47–60

39 Bibikova TN, Blancaflor EB, Gilroy S. Microtubules regulate tip growth and orientation in root hairs of Arabidopsis thaliana. Plant J, 1999, 17: 657–665

40 Luo D, Oppenheimer DG. Genetic control of trichome branch number in Arabidopsis: The roles of the FURCA loci. Development, 1999,126: 5547– 5557

41 Oppenheimer DG, Pollock MA, Vacik J, Szymanski DB, Ericson B, Feldmann K, Marks MD. Essential role of a kinesin-like protein in Arabidopsis trichome morphogenesis. Proc Natl Acad Sci USA, 1997, 94: 6261–6266

42 Mathur J, Chua NH. Microtubule stabilization leads to growth reorientation in Arabidopsis trichomes. Plant Cell, 2000, 12: 465–477

43 Yephremov A, Wisman E, Huijser P, Huijser C, Wellesen K, Saedler H. Characterization of the FIDDLEHEAD gene of Arabidopsis reveals a link between adhesion response and cell differentiation in the epidermis. Plant

Cell, 1999, 11: 2187–2201

44 Pruitt RE, Vielle-Calzada JP, Ploense SE, Grossniklaus U, Lolle SJ. FIDDLEHEAD, a gene required to suppress epidermal cell interactions in Arabidopsis, encodes a putative lipid biosynthetic enzyme. Proc Natl Acad

Sci USA, 2000, 97:1311–1316

45 Sinha N. The response of epidermal cells to contact. Trends Plant Sci, 2000, 5: 233–234

Received: August 27, 2003 Accepted: October 22, 2003

This work was supported by a grant from the Chinese Ministry of Science and Technology (No. J99-A-03)

* Corresponding author: Tel, 86-10-62751193; Fax, 86-10-62754427; E-mail, [email protected]